[SOLVED] DNA Mutation Simulation

DNA Mutation Simulation – Access the simulation at: ?https://www.biologycorner.com/worksheets/DNA-sim.html 1) Transcribe and Translate your original DNA. Review those terms and write a short definition Transcription: Translation: 2) Identify the major players shown in the simulation: mRNA, Codon, Amino Acid, tRNA, anticodon, ribosome. Use the figure below to label these parts.3. When the protein is completed, write the sequence of amino acids shown, there are 11. (Hint: click the “stop” button to make the model stop jiggling.) 4. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG 5. Edit the DNA by changing all of the first triplet to AAA Check the new protein created by your new DNA. Describe how this changed the protein..biologycorner.comhttps://www.biologycorner.com/worksheets/DNA-sim.htmlhttp://www.biologycorner.com/6. Return the triplet to its original state (ATG). Now place an additional A after the G, your strand will read ATGA. ?Check the new protein created by your new DNA. Describe how this changed the protein. 7. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC. Check the new protein created by your new DNA. Describe how this changed the protein. Final Analysis – There are three mutations you explored in this activity. You can use what you observed in the activity to help you answer the questions or search other sources if you are still confused. 8. First, you created a ?POINT? mutation in your DNA. Describe what a point mutation is an how this can affect the protein created by the gene. 9. The second mutation you explored is called a ?FRAMESHIFT? mutation. Explain what this means and how it affects the protein. 10. The third mutation you explored is a special kind of point mutation called a ?SILENT? mutation. Explain what this means.www.biologycorner.comhttp://www.biologycorner.com/

Don't use plagiarized sources. Get Your Custom Essay on
[SOLVED] DNA Mutation Simulation
Get a 15% discount on this Paper
Order Essay
Quality Guaranteed

With us, you are either satisfied 100% or you get your money back-No monkey business

Check Prices
Make an order in advance and get the best price
Pages (550 words)
$0.00
*Price with a welcome 15% discount applied.
Pro tip: If you want to save more money and pay the lowest price, you need to set a more extended deadline.
We know that being a student these days is hard. Because of this, our prices are some of the lowest on the market.

Instead, we offer perks, discounts, and free services to enhance your experience.
Sign up, place your order, and leave the rest to our professional paper writers in less than 2 minutes.
step 1
Upload assignment instructions
Fill out the order form and provide paper details. You can even attach screenshots or add additional instructions later. If something is not clear or missing, the writer will contact you for clarification.
s
Get personalized services with My Paper Support
One writer for all your papers
You can select one writer for all your papers. This option enhances the consistency in the quality of your assignments. Select your preferred writer from the list of writers who have handledf your previous assignments
Same paper from different writers
Are you ordering the same assignment for a friend? You can get the same paper from different writers. The goal is to produce 100% unique and original papers
Copy of sources used
Our homework writers will provide you with copies of sources used on your request. Just add the option when plaing your order
What our partners say about us
We appreciate every review and are always looking for ways to grow. See what other students think about our do my paper service.
IT, Web
Don did an excellent job!!!
Customer 452885, January 25th, 2023
Human Resources Management (HRM)
Thanks
Customer 452701, August 22nd, 2023
IT, Web
Excellent job on the paper!
Customer 452885, December 28th, 2022
Professions and Applied Sciences
Thank you!
Customer 452707, March 4th, 2022
Social Work and Human Services
Perfect. Thank you.
Customer 452469, July 10th, 2021
Nursing
Not all sources were " American sources" as directed
Customer 452615, September 16th, 2021
Other
Awesome Work!
Customer 452587, February 24th, 2022
Political science
THANK YOU
Customer 453001, April 25th, 2024
Computer science
extremely happy with the service, again! You guys are the best.
Customer 452715, July 27th, 2022
Nursing
Amazing work! I passed the assignment!
Customer 452707, August 20th, 2022
Human Resources Management (HRM)
awesome job
Customer 452701, August 14th, 2023
Nursing
Always on time and a life saver for sure!!!!!!!!!!!!
Customer 452453, October 22nd, 2021
Enjoy affordable prices and lifetime discounts
Use a coupon FIRST15 and enjoy expert help with any task at the most affordable price.
Order Now Order in Chat

Ensure originality, uphold integrity, and achieve excellence. Get FREE Turnitin AI Reports with every order.