[CUSTOM SOLUTION] DNA Mutation Simulation

DNA Mutation Simulation – Access the simulation at: ?https://www.biologycorner.com/worksheets/DNA-sim.html 1) Transcribe and Translate your original DNA. Review those terms and write a short definition Transcription: Translation: 2) Identify the major players shown in the simulation: mRNA, Codon, Amino Acid, tRNA, anticodon, ribosome. Use the figure below to label these parts.3. When the protein is completed, write the sequence of amino acids shown, there are 11. (Hint: click the “stop” button to make the model stop jiggling.) 4. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG 5. Edit the DNA by changing all of the first triplet to AAA Check the new protein created by your new DNA. Describe how this changed the protein..biologycorner.comhttps://www.biologycorner.com/worksheets/DNA-sim.htmlhttp://www.biologycorner.com/6. Return the triplet to its original state (ATG). Now place an additional A after the G, your strand will read ATGA. ?Check the new protein created by your new DNA. Describe how this changed the protein. 7. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC. Check the new protein created by your new DNA. Describe how this changed the protein. Final Analysis – There are three mutations you explored in this activity. You can use what you observed in the activity to help you answer the questions or search other sources if you are still confused. 8. First, you created a ?POINT? mutation in your DNA. Describe what a point mutation is an how this can affect the protein created by the gene. 9. The second mutation you explored is called a ?FRAMESHIFT? mutation. Explain what this means and how it affects the protein. 10. The third mutation you explored is a special kind of point mutation called a ?SILENT? mutation. Explain what this means.www.biologycorner.comhttp://www.biologycorner.com/

Assignment posted by client #4327***