[SOLVED] DNA Mutation Simulation

DNA Mutation Simulation – Access the simulation at: ?https://www.biologycorner.com/worksheets/DNA-sim.html 1) Transcribe and Translate your original DNA. Review those terms and write a short definition Transcription: Translation: 2) Identify the major players shown in the simulation: mRNA, Codon, Amino Acid, tRNA, anticodon, ribosome. Use the figure below to label these parts.3. When the protein is completed, write the sequence of amino acids shown, there are 11. (Hint: click the “stop” button to make the model stop jiggling.) 4. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG 5. Edit the DNA by changing all of the first triplet to AAA Check the new protein created by your new DNA. Describe how this changed the protein..biologycorner.comhttps://www.biologycorner.com/worksheets/DNA-sim.htmlhttp://www.biologycorner.com/6. Return the triplet to its original state (ATG). Now place an additional A after the G, your strand will read ATGA. ?Check the new protein created by your new DNA. Describe how this changed the protein. 7. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC. Check the new protein created by your new DNA. Describe how this changed the protein. Final Analysis – There are three mutations you explored in this activity. You can use what you observed in the activity to help you answer the questions or search other sources if you are still confused. 8. First, you created a ?POINT? mutation in your DNA. Describe what a point mutation is an how this can affect the protein created by the gene. 9. The second mutation you explored is called a ?FRAMESHIFT? mutation. Explain what this means and how it affects the protein. 10. The third mutation you explored is a special kind of point mutation called a ?SILENT? mutation. Explain what this means.www.biologycorner.comhttp://www.biologycorner.com/

Don't use plagiarized sources. Get Your Custom Essay on
[SOLVED] DNA Mutation Simulation
Get a 15% discount on this Paper
Order Essay
Quality Guaranteed

With us, you are either satisfied 100% or you get your money back-No monkey business

Check Prices
Make an order in advance and get the best price
Pages (550 words)
$0.00
*Price with a welcome 15% discount applied.
Pro tip: If you want to save more money and pay the lowest price, you need to set a more extended deadline.
We know that being a student these days is hard. Because of this, our prices are some of the lowest on the market.

Instead, we offer perks, discounts, and free services to enhance your experience.
Sign up, place your order, and leave the rest to our professional paper writers in less than 2 minutes.
step 1
Upload assignment instructions
Fill out the order form and provide paper details. You can even attach screenshots or add additional instructions later. If something is not clear or missing, the writer will contact you for clarification.
s
Get personalized services with My Paper Support
One writer for all your papers
You can select one writer for all your papers. This option enhances the consistency in the quality of your assignments. Select your preferred writer from the list of writers who have handledf your previous assignments
Same paper from different writers
Are you ordering the same assignment for a friend? You can get the same paper from different writers. The goal is to produce 100% unique and original papers
Copy of sources used
Our homework writers will provide you with copies of sources used on your request. Just add the option when plaing your order
What our partners say about us
We appreciate every review and are always looking for ways to grow. See what other students think about our do my paper service.
Nursing
Fantastic work on this project as usual.
Customer 452707, July 5th, 2022
Social Work and Human Services
Excellent Work!
Customer 452587, August 24th, 2021
Nursing
Excellent work!! Thanks again!
Customer 452707, October 14th, 2022
Nursing
Paid for the paper to be completed 5 days prior than the day I received the paper.
Customer 452693, July 13th, 2022
Human Resources Management (HRM)
Thank you
Customer 452531, May 19th, 2021
Human Resources Management (HRM)
Thanks.
Customer 452701, August 1st, 2023
Nursing
Great paper!
Customer 452707, January 14th, 2024
Human Resources Management (HRM)
This paper is well -written from what I have read. If there are any instructor concerns, I will advise.
Customer 452701, October 24th, 2023
Other
AWESOME
Customer 452813, June 25th, 2022
Nursing
They research and provide the best and up-to-date information..
Customer 452707, June 27th, 2023
Technology
i would like if they would attach the turnin report with paper
Customer 452901, August 17th, 2023
Business and administrative studies
GREAT
Customer 452813, June 20th, 2022
Enjoy affordable prices and lifetime discounts
Use a coupon FIRST15 and enjoy expert help with any task at the most affordable price.
Order Now Order in Chat

Ensure originality, uphold integrity, and achieve excellence. Get FREE Turnitin AI Reports with every order.