Biology
[SOLVED] DNA in our genes
Rewrite Please 1. Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells 2. Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease. 3. Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand comment on how this has affected the resulting peptide chain. Link for Chapter 15: https://my.uopeople.edu/pluginfile.php/1015434/mod_page/content/6/BIOL1121-Textbook-Ch11_Ch20.pdf 1. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc 2. aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
[SOLVED] the field of metagenomics
hapter 17 discusses trends in biotechnology and the field of metagenomics. For your discussion post: Chapter 17 Link: https://my.uopeople.edu/pluginfile.php/1015434/mod_page/content/6/BIOL1121-Textbook-Ch11_Ch20.pdf 1. Explain why metagenomics is probably the most revolutionary application of genomics. What application of genomics would best serve your community and why? 2. Research?Bioremediation?as an application of metagenomics, and comment on how this mechanism can be utilized as an environmental management intervention within your community. Here are some videos to get you started: 1. Can microbes clean up our oily mess? Video Link: https://www.kaltura.com/index.php/extwidget/preview/partner_id/1934481/uiconf_id/45150521/entry_id/0_mu9e5u96/embed/thumb? 2. Researchers could use microbes to clean up mine sites? Video Link: https://www.kaltura.com/index.php/extwidget/preview/partner_id/1934481/uiconf_id/45150521/entry_id/0_k9wqzuj5/embed/thumb?
[SOLVED] Molecular Biology
Comparison of initiation, elongation, and termination in replication, transcription, and translation Cite your sources! By submitting this paper, you agree: (1) that you are submitting your paper to be used and stored as part of the SafeAssign services in accordance with the Blackboard Privacy Policy; (2) that your institution may use your paper in accordance with your institution’s policies; and (3) that your use of SafeAssign will be without recourse against Blackboard Inc. and its affiliates. Institution Release Statement Your paper will be submitted to originality check through SafeAssign, a Blackboard tool that compares students’ assignments against Web sources worldwide and productions of other students at BSU. For more information on Molecular Biology read this:https://en.wikipedia.org/wiki/Molecular_biology
[SOLVED] Island Biogeography
QUESTION 9 Explain the theory of island biogeography. What factors determine the rate of immigration (new species establishment) and extinction? Your response should be at least 200 words in length. For more information on Island Biogeography read this: https://en.wikipedia.org/wiki/Insular_biogeography
[SOLVED] Heart Disease
Valvular heart disease assignment For more information on Heart Disease read this: https://en.wikipedia.org/wiki/Cardiovascular_disease
[SOLVED] Anatomy
An 18-year-old female is being seen in the office for lower abdominal pain and irregular menstrual bleeding. The physician wants to rule out PID and endometriosis. What are the sign and symptoms, and etiology of PID and endometriosis? What diagnostic test would the physician order? The physician also orders a CA125, what is this test used for? A 19-year-old male is being seen in the office for a red, swollen, and painful left scrotum. What are the risk factors, diagnostic tests, treatment, and prevention for epididymis and orchitis? Which STD scares you the most especially if you have teenagers and young adults, why? Identify and discuss the function of hormones of the anterior pituitary and posterior pituitary. If a 10-year-old patient is in anterior pituitary failure, what would you expect to see? What are the signs and symptoms of thyroid cancer? After a thyroidectomy, what medications will be required for the rest of the patients life? What purpose does the parathyroid have? If during the thyroidectomy, the parathyroid glands also removed, what does this mean for the patient? For more information on Anatomy read this: https://en.wikipedia.org/wiki/Anatomy
[SOLVED] Biodiversity
Instructions Based on what you learned in Unit IV, describe the biodiversity in the area you live in. What kind of habitat do you live in, and what plants and organisms are common? What are some of the ecosystem services this biodiversity provides for you and your city or town? Your journal entry must be at least 200 words. No references or citations are necessary. For more information on Biodiversity read this: https://en.wikipedia.org/wiki/Biodiversity
[SOLVED] Skeletomuscular System
The skeletomuscular system allows us to move through the environment using different modes including walking, running, eating, typing on a computer, and even driving a car. But sometimes accidents happen, like a slip on the ice resulting in a broken wrist, or a long run leading to achy joints. Respond to the two topics below for this units Discussion. Many of us know someone who has broken (or fractured) a bone, whether it is a wrist, ankle, or hip. What are the different types of bone fractures? How does bone remodel itself? What are the different ways a doctor may treat a fractured bone? Have you or someone you know had a fracture? How was it treated? What was the outcome? John is training for a marathon and recently he has been experiencing knee pain. He subsequently went to the doctor for a diagnosis. What are the possible diagnoses for his knee pain? What is the structure and function of the synovial joint of the knee? What is knee synovitis?
[SOLVED] Patient Malnutrition
The discussion assignment provides a forum for discussing relevant topics for this week based on the course competencies covered. For this assignment, make sure you post your initial response to the Discussion Area by the due date assigned. To support your work, use your course and text readings and use outside sources. As in all assignments, cite your sources in your work and provide references for the citations in APA format. Start reviewing and responding to the postings of your classmates as early in the week as possible. Respond to at least two of your classmates. Participate in the discussion by asking a question, providing a statement of clarification, providing a point of view with a rationale, challenging an aspect of the discussion, or indicating a relationship between two or more lines of reasoning in the discussion. Complete your participation for this assignment by the end of the week. Patient Malnutrition Patient malnutrition is a very real and serious matter; it can lead to a worsening of the patient’s condition, a longer hospital stay, or even be as serious as to contribute to patient death. There are a variety of diseases, conditions, or situations in which patient malnutrition may occur; the malnutrition may develop while in the hospital, but it can also develop outside of the hospital as well. Choose a disease, condition, or situation in which a patient is likely to develop malnutrition and describe the characteristics or details of it. Note how malnutrition might develop in a patient (this could be a result of treatments, financial issues, drug interactions, etc.) and possible consequences of malnutrition. In addition, discuss how malnutrition may be prevented, managed, or reversed in the patient. Are there specific tests that can be done to determine the nutritional status of your patient?
[SOLVED] Imbalance in Biogeochemical Cycling
For this essay examination, answer the following questions in one to two short paragraphs each. Type your answers in a Word file and name the file with your name and the exam number. Explain how human activities can cause an imbalance in biogeochemical cycling and lead to problems such as cultural eutrophication and fish kills. Compare and contrast the traits and growth patterns of opportunistic versus equilibrium populations. Provide one example of each. Compare and contrast indirect versus direct values of biodiversity, and provide examples. Describe two traits that represent a sustainable society and two traits of a non-sustainable society.
Use Promo Code: FIRST15