Biology

write an essay about why junk food is unhealthy.

For this essay examination, answer the following questions in one to two short paragraphs each. Type your answers in a Word file and name the file with your name and the exam number. Explain how human activities can cause an imbalance in biogeochemical cycling and lead to problems such as cultural eutrophication and fish kills. Compare and contrast the traits and growth patterns of opportunistic versus equilibrium populations. Provide one example of each. Compare and contrast indirect versus direct values of biodiversity, and provide examples. Describe two traits that represent a sustainable society and two traits of a non-sustainable society.

For each disorder create a story of your life as if you have these disorders. Write ONE story for each disorder: (1) Major Depression (2) Bipolar (3) Schizophrenia ( I NEED THE FIRST ONE MAJOR DEPRESSION. You should post THREE stories ( Do the first one page ) – You must discuss: The symptoms that you experience, You should not experience all of them, Make sure the symptoms match the cause, if possible, ONE cause, Your disorders cannot have more than ONE cause,  Neurotransmitters and/or brain structures involved, Only those neurotransmitters and/or brain structures related to the cause that you chose, THREE types of treatments that you have tried and which ONE actually worked, Assume you know everything about your disorder, you have tried 3 treatments, you know the cause and the neurotransmitters/brain structures involved.

1. what are the bloods main function? give 5 specific examples with detailed explanation. 2. what are the main components of blood? give 3 specific examples with a detailed explanation of their role and purpose. Address each question in a single essay style document with each topic separated with the APA level heading and include a conclusion paragraph. APA format, Times new Roman, 12 font, double-spaced, 900 words minimum

hapter 17 discusses trends in biotechnology and the field of metagenomics. For your discussion post: Chapter 17 Link: https://my.uopeople.edu/pluginfile.php/1015434/mod_page/content/6/BIOL1121-Textbook-Ch11_Ch20.pdf 1. Explain why metagenomics is probably the most revolutionary application of genomics. What application of genomics would best serve your community and why? 2. Research?Bioremediation?as an application of metagenomics, and comment on how this mechanism can be utilized as an environmental management intervention within your community. Here are some videos to get you started: 1. Can microbes clean up our oily mess? Video Link: https://www.kaltura.com/index.php/extwidget/preview/partner_id/1934481/uiconf_id/45150521/entry_id/0_mu9e5u96/embed/thumb? 2.  Researchers could use microbes to clean up mine sites? Video Link: https://www.kaltura.com/index.php/extwidget/preview/partner_id/1934481/uiconf_id/45150521/entry_id/0_k9wqzuj5/embed/thumb?

Rewrite Please 1. Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells   2. Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.  3. Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.  You will notice that the second strand has a point deletion  (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. Link for Chapter 15: https://my.uopeople.edu/pluginfile.php/1015434/mod_page/content/6/BIOL1121-Textbook-Ch11_Ch20.pdf   1. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc   2. aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

After reading the section on Intelligence in Chapter 7, what is your personal definition of “intelligence?” What specific characteristics and attributes do you believe are of primary importance in distinguishing between high vs. low intelligence?Identify and describe in your own words the theory of intelligence (feel free to do additional research on your chosen theory) that you most strongly believe in? and tell us why you think it is the “best” theory or explanation of intelligence? Then, tell us which theory you believe is the “worst” and why?

Before writing starting your paper, read “How To Read And Use A Case Study”.DeliverableA. Read the Haier’s North America Expansion case studyB. Answer the following questions (all):B. Questions1. What were the factors behind Haier’s decision to start production in the U.S. in 1999?2. Do a PESTEL analysis of the external environment for Haier USA.2. Do a Porter’s Five Forces analysis of the U.S. white goods industry.3. Do a SWOT analysis for Haier USA.4. Why did Haier buy GE? What change can GE employees expect from the change in ownership/management? Also, discuss the impact of the differences in national and organizational cultures, and how can Haier, the new owner, overcome them?5. What are the strategic implications of emerging Chinese multinationals such as Haier?6. How will Haier’s success in the US market support its operations and investments in its global markets?00B. General Instructions & Requirements1. Use UMGC’s Library (mainly) for research in this assignment.2. Only use scholarly and reliable non-scholarly sources such as Bloomberg, Reuters, Statista, WSJ, FT, Money, Forbes, and Fortune (no answer.com, QuickMBA, eHow, Wikipedia…….).3. Assignment should be supported by at least four scholarly (peer-reviewed articles to support concepts), and at least six reliable non-scholarly sources (to provide consumer, market, and industry information); in addition to the course readings.4. Assignment should be written in a paper format; not a question and answer format.5. Please include the following: A one-page executive summary, a half page Introduction, and a half page Lessons Learned & Conclusion at the end of your paper.5. All questions are to be attempted. Relate your answers to research and course reading. Do not restate the information from the case study; go beyond the included information; analyze!6. Paper should be 11 – 12 pages long, with one-inch margins, 12-point font, double-spacing, and should be posted as a Word document. The cover page, reference list, and appendix are not part of the page count. All graphics (if used) should be placed in the appendix.7. Use APA format for intext citations and the reference list.8. Case reference

Approximately 9,500 individuals in the United States have been diagnosed with skin cancer. When the body fails to restore damage to the DNA within skin cells, cancer develops, causing the cells to differentiate and multiply uncontrollably. Several variables, including genetics and skin type, may trigger skin cell damage. The majority of cases of skin cancer are caused by excessive sensitivity to the sun’s ultraviolet (UV) radiation. Skin cancer may be a black patch, a lesion, a healing wound, or a lump in the skin (Linos, et al., 2016). Studies have indicated that over 3 million Americans are affected every year by nonmelanoma skin cancer, mainly squamous cell carcinoma (SCC) and basal cell carcinoma (BCC). Studies also show that total BCC incidence rose 145% from 1976 to 1984 and from 2000 to 2010 and that over the same time, the cumulative rate of SCC grew 263%. Melanoma is by far the most common form of skin cancer. Once melanoma spreads deeper into the skin, it becomes more complex to handle. The United States has seen an exponential increase in melanoma prevalence in the past 30 years—doubling between 1982 and 2011—but patterns in the past decade differ by generation (Park et al., 2020). The prevalence of melanoma has started to decrease in teens and young adults aged 30 and below. In comparison, the prevalence of melanoma in older age groups has risen with more marked changes in persons aged 80 or older. Individuals with darker complexions are more prone to developing skin cancer on the soles of the feet, the groin, the palms of the hands of their feet, and the inside of their lips, which aren’t often exposed to the light. Additionally, they can grow melanoma under their nails (Iannacone et al., 2014). The prevalence of melanoma is greater in females than in males before the age of 50 years, but the prevalence in males is double by the age of 65 years and almost three times by the age of 80 years. Almost twenty people die every day with melanoma. Melanoma was expected to claim the lives of 6,850 people in 2020, including 4,610 men and 2,240 women. In 2020, the United States projected to have an unprecedented 4,630 losses from skin cancers apart from melanoma and NMSC (Park et al., 2020).Telemedicine is a new field that should not be excluded from skincare: In recent years, users have been able to examine the skin with their smartphones and artificial intelligence algorithms using a handful of skin cancer identification applications. Others give pictures to a dermatologist, whilst others get immediate guidance and supportive tips about self-checking their skin and making an appointment with a doctor. Each year physicians diagnose in the USA, and in 2019, about 200.000 patients will get a diagnosis of melanoma, over 4 million nonmelanomas (such as squamous and basal cell). Basal and spongy cell cancers are more prevalent than melanoma and form on the outer layers of the skin (Park et al., 2020). The skin pigmentation of the cells known as melanocytes is affected by it. It is an active type of cancer that kills about 10,000 people a year. It can be lethal even with early diagnosis. Melanoma of the skin has a 5-year relative survival rate of 93 percent when all phases are combined. When melanoma is detected before it spreads, the relative survival rate over 5 years is 99 percent. At the moment, 83 percent of diagnoses remain in the early stages of development (Tyagi et al., 2012).

Nearly all the antibiotics used to stop bacterial infections are natural compounds that come from microbes themselves. For example, penicillin is derived from a fungus, while vancomycin, the antibiotic used when bacteria are resistant to many other drugs, comes from a bacterium. Furthermore, although many antibiotics are chemically synthesized to resemble natural antibiotics, the “models” for them are natural products of microbes themselves.As more bacteria become resistant to traditional antibiotics, alternative drugs must be found. Recently, scientists discovered a completely new type of antibiotic that comes from Hydra, pictured above, a small freshwater creature famous for regenerating itself when its tissues are severed. While investigating defensive mechanisms on the skin of hydras in 2008, scientists at the University of Keil in Germany came across a protein that is active against both gram-negative and gram-positive bacteria. Most importantly, it works against some drug-resistant strains of bacteria. They named this protein hydramacin.- Can you imagine why microbes produce chemicals that are inhibitory to other microbes?- What enables a new drug to be effective against bacteria that are able to resist old drugs?- How do you suppose the scientists figured out that the compound in Hydra acts against both gram-negative and gram-positive bacteria?Ref.: Cowan, M. K. (2014) (4th Ed.). Microbiology: A Systems Approach, McGraw Hill