[CUSTOM SOLUTION] Clear Cell Carcinoma

How is clear cell carcinoma linked to vaginal cancer?

Read more

[CUSTOM SOLUTION] The immune system

Topic: The immune system is a daunting system to cover. However, it is critical for a healthcare professional to understand how the immune system works. This week you will provide a written response that analyzes the mechanism of action for the three lines of defense in the immune system.Assignment Expectations:You will write a 2000-2250 word essay, not including the Title and References pages (typed,12 point font, double spaced).In addition, I have included a link to research article (Item 10). You should read and provide a review of this article in item 10.Required Topics to Address:Physical barriers, the first line of defenseThe second line of defense, the innate immune systemPhagocytosisImmunological SurveillanceInterferonsInflammationThe third line of defense, humoral immunityAntibody structure and classesThe third line of defense, cell-mediated immunityVaccines and pseudoscience (review this article and provide a summary:http://www.miottawa.org/Health/OCHD/pdf/2007_Nature_DeStefano_Vaccines_and_Autism.pdf)References- Support your content with at least (5) citations. Make sure to reference the citations using APA writing style for the presentation.

Read more

[CUSTOM SOLUTION] Health Care Reform Provisions

From the Executive Perspective:The CEO of North Eastern Hospital (NEH), Jim James, had been playing the waiting game, assuming that he had plenty of time to prepare for how his institution would be impacted by the Affordable Care Act (ACA). When the Supreme Court upheld the constitutionality of President Obama’s signature legislation in June 2012, Jim realized he and his staff needed to quickly rethink the hospital’s position and shift strategies. While they had initially seen the health care reform provisions of the ACA as burdensome, now he wanted the staff to think about the opportunities that it offered and how it could enhance NEH and help it to fulfill its mission in serving the community.The more Jim read and thought about the provisions of the new law, the more convinced he became of the benefits. Since the primary goal of the ACA was to bring the uninsured into coverage, large number of uninsured individuals in the community would soon have access to care. And, with insurance companies being required to provide coverage for those with preexisting conditions, these folks would have access.There were many negative stereotypes associated with both groups. While some of these people were indeed very ill, it was also clear that the fact that people didn’t have insurance did not necessarily mean they were sick. In reality, many were healthy individuals who, for whatever reason, were uninsured. Some were seasonal workers in organizations that didn’t provide coverage to their employees, others opted not to buy coverage, and there were those who just could not afford it and would now be subsidized. Additionally, some with preexisting conditions had in the past been denied insurance coverage on the basis of relatively minor problems such as sinusitis, a prior knee injury, and removal of a small benign tumor and so on.This looked to Jim like bonanza. Jim wanted to find ways to connect these groups to his hospital, as well as its associated outpatient clinics and excellent pool of physicians and other health care professionals. This led him to thinking about new programs, modifying existing programs, developing marketing strategies, finding ways to capitalize on the pent-up demand for services in the short run, and becoming the provider of choice in the long run.(3) What marketing strategies might be developed to attract this new clientele?

Read more

[CUSTOM SOLUTION] Software Program

Required ResourcesRead/review the following resources for this activity:Textbook: Chapter 13LessonMinimum of 1 scholarly source (in addition to the textbookIntroductionSome people believe that you can tell who a person is by what they do when no one is looking. Let’s look at the following case. John Doe, a nurse, has downloaded an application to her phone that allows him to download copyrighted textbooks for a nursing course (that Doe is going to take) without his Internet Service Provider knowing it. The application is called “Cloak” as in cloak of invisibility (a hooded coat one wears to make it so others cannot see you). The application disguises his phone and makes it so the information on it is inaccessible. John is aware that other people who are of a lower socio-economic status (like him) also use this software program for the same reason (and to save money). John Doe knows that his religion forbids him from using this application to download in this manner. John Doe is focused on his own economic situation and does not consider the publisher, author, and others involved in the books. Think about a course of social action; what social values should be used to address this moral issue and conflict.Initial Post InstructionsCreate a personal ethical philosophy and explain from which philosophy or philosophies (it must include at least one of the following: virtue ethics, Kantian ethics, utilitarianism, virtue ethics, or social contract ethics) you created it and why the contents are important and meaningful for you. List its precepts.Take your personal ethical philosophy statement and use it to work through John Doe’s case. What is moral and immoral per your theory?How would the veil of ignorance or a different theory of justice address John Doe’s case?Follow-Up Post InstructionsRespond to at least one peer. When possible, respond to a peer who chose a different ethical theory than you did in your posting. Further the dialogue by providing more information and clarification.Writing RequirementsMinimum of 2 posts (1 initial & 1 follow-up)Minimum of 2 sources cited (assigned readings/online lessons and an outside scholarly source)APA format for in-text citations and list of references

Read more

[CUSTOM SOLUTION] The Symbiotic Relationship

Important ideas to understand as you watch the video:1. Is the symbiotic relationship between the coral and the algae parasitic or mutualistic? Why do you think this? If you need help, use this resource.2. How does the temperature of the water impact the algae?3. Why are the coral reefs becoming the white or “bleached” color?4. Do you think Australia should approve the coal mining? Why or why not?5. Do you think that this thermal pollution is point or nonpoint source? Why or why not?

Read more

[CUSTOM SOLUTION] DNA Mutation Simulation

DNA Mutation Simulation – Access the simulation at: ?https://www.biologycorner.com/worksheets/DNA-sim.html 1) Transcribe and Translate your original DNA. Review those terms and write a short definition Transcription: Translation: 2) Identify the major players shown in the simulation: mRNA, Codon, Amino Acid, tRNA, anticodon, ribosome. Use the figure below to label these parts.3. When the protein is completed, write the sequence of amino acids shown, there are 11. (Hint: click the “stop” button to make the model stop jiggling.) 4. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG 5. Edit the DNA by changing all of the first triplet to AAA Check the new protein created by your new DNA. Describe how this changed the protein..biologycorner.comhttps://www.biologycorner.com/worksheets/DNA-sim.htmlhttp://www.biologycorner.com/6. Return the triplet to its original state (ATG). Now place an additional A after the G, your strand will read ATGA. ?Check the new protein created by your new DNA. Describe how this changed the protein. 7. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC. Check the new protein created by your new DNA. Describe how this changed the protein. Final Analysis – There are three mutations you explored in this activity. You can use what you observed in the activity to help you answer the questions or search other sources if you are still confused. 8. First, you created a ?POINT? mutation in your DNA. Describe what a point mutation is an how this can affect the protein created by the gene. 9. The second mutation you explored is called a ?FRAMESHIFT? mutation. Explain what this means and how it affects the protein. 10. The third mutation you explored is a special kind of point mutation called a ?SILENT? mutation. Explain what this means.www.biologycorner.comhttp://www.biologycorner.com/

Read more

[CUSTOM SOLUTION] Impact of Gene Fusion

Topic: Discuss the pathological and prognostic impact of gene fusion in blood cancer.Key points:1- the normal function of gene before the fusion event2- the altered function of gene post fusion3-How the altered function of fused genes affects the disease progression/initiation4- How the altered function of fused genes affects the disease prognosis5- Text paraphrasing should be applied as the text will be scanned for text similarity6- Make a good use of referencing system of your choice8 the format of the text is: Abstract–> introduction–>body of the topic —> conclusion.9- Reference should include text books and papers.

Read more

[CUSTOM SOLUTION] The Chemistry of Digestion

The Chemistry of DigestionWhat is important to understand about the chemistry of digestion is that we consume macromolecules in our diet: proteins, carbohydrates, and fats or lipids; and through chemical digestion the substances are broken down into their simplest parts: amino acids, monosaccharides or simple sugars, and fatty acids. Enzymes, proteins that are used to catalyze these reactions are made by our bodies. It is amazing to witness, and in the test tube we can see the results of enzymes and their role in digestion.A lactose intolerant person, for example, simply fails to produce lactase. Lactase is the enzyme necessary to breakdown lactose. Maltase breaks down maltose, and sucrase breaks down sucrose.1. Name the test solution or the reagent use to test for the presence of the following, name the initial color, and the positive result indicator. You may list the information in a table form if you choose.StarchGlucoseProteinLipid2. What do you do if you get unexpected results, when doing this type of experimentation?

Read more

[CUSTOM SOLUTION] Secrecy and Discretion

Hi, am Abell Arora independent high-profile model Escort in Chandigarh any time at any hotel like your location or mine location. Incall and outcall are both available. Full-service guarantee in your time no west money in fake agency call or WhatsApp Riya Kapoor. Treat you like your girlfriend. If you want to spend your time doing something else, a luxurious night with beautiful Chandigarh escorts is the best way to do it in Chandigarh. Since there are so many of them, it is good to know a bit about them before you select an escort. Make sure that you are comfortable with the person you select. Select someone who is willing to take the time to listen to your needs and wants. The hotels and motels in Chandigarh cannot be compared to the services that the Chandigarh escort services provide. Some of the escorts of Chandigarh who travel around offering their services often don’t even consider going to Chandigarh because they think it is a ‘blah’ place. What they don’t realize is that in Chandigarh, they can find just about anything. Being able to enjoy your time with the person of your fantasy also needs secrecy and discretion. Besides that, you do not want to be infected with something embarrassing. That is the reason Chandigarh Escorts sign up anon disclosure agreement with the Escort Service in Chandigarh and is only appointed after a complete background verification

Read more

[CUSTOM SOLUTION] Biotechnology Methods

Generically modified (GM) foods produced through biotechnology methods are considered unsafe by some in the scientific community and they are often of the opinion that only organically grown foods should be consumed. Many foods are labeled non-GMO today and subject consumers to higher prices to purchase these products that claim to be organically grown and free of any bioengineering. Other agricultural scientists claim that even organic foods may have been created through farming practices such as hybridization or cross breeding and are not harmful to consume. And, still others believe the term “Frankenfoods” has created widespread distrust and is used as a scare tactic to cause consumers to turn to alternate food choices often at a higher cost.For this assignment, read a scientific article or report about a GMO food(s) from an authentic source such as an .edu or .gov website.Then, write 5 or 6 sentences and give your opinion about whether genetically modified foods should be consumed or not.Things to make note of in determining an authentic website and source:1. The credentials of the Author (Persons with a History PhD are doctors but are not an authentic source for biological issues.)2. Is there a conflict of interest for the organization and the information released3. Is there contradictory information released by authentic sources?4. Other red flags of non-authentic websites to look for can be found in this article: https://healthcentral.nz/10-red-flags-of-junk-science/ (Links to an external site.)You are not required to read an article in a scientific journal but the article you choose to use as reference must be from a reputable source.Write your view of GMO versus non-GMO foods in 5 – 6 sentences and in your own words. Include a photo of a non-GMO food with your posting (can be taken from the Internet or other sources – photo must be visible). Include in your writing your thoughts about: Do you purchase food that is labeled non-GMO because you feel it is safer? Why or why not?

Read more
Enjoy affordable prices and lifetime discounts
Use a coupon FIRST15 and enjoy expert help with any task at the most affordable price.
Order Now Order in Chat

Ensure originality, uphold integrity, and achieve excellence. Get FREE Turnitin AI Reports with every order.