Biology

Length should be 1250-1500 words, not including Title and References pages (typed, 12 point font, double spaced).These subheadings are required (content expectation is also provided)Introduction (list the three mechanisms that you have picked and provide a brief overview)Mechanism 1 (Describe the cellular source of the mechanism. Explain how this mechanism produces an effect inside the host. Provide an example pathogen that utilizes this mechanism).Mechanism 2 (Describe the cellular source of the mechanism. Explain how this mechanism produces an effect inside the host. Provide an example pathogen that utilizes this mechanism).Mechanism 3 (Describe the cellular source of the mechanism. Explain how this mechanism produces an effect inside the host. Provide an example pathogen that utilizes this mechanism).Professional application (Explain how understanding these mechanisms increases the effectiveness of a nurse).Support your content with at least (3) citations. Make sure to reference the citations using APA writing style for the presentation.Format:Save your assignment as a Microsoft Word FilFile name:Name your saved file according to your last name, first initial and the week (for example, “jonesb.week1”)

From the Executive Perspective:The CEO of North Eastern Hospital (NEH), Jim James, had been playing the waiting game, assuming that he had plenty of time to prepare for how his institution would be impacted by the Affordable Care Act (ACA). When the Supreme Court upheld the constitutionality of President Obama’s signature legislation in June 2012, Jim realized he and his staff needed to quickly rethink the hospital’s position and shift strategies. While they had initially seen the health care reform provisions of the ACA as burdensome, now he wanted the staff to think about the opportunities that it offered and how it could enhance NEH and help it to fulfill its mission in serving the community.The more Jim read and thought about the provisions of the new law, the more convinced he became of the benefits. Since the primary goal of the ACA was to bring the uninsured into coverage, large number of uninsured individuals in the community would soon have access to care. And, with insurance companies being required to provide coverage for those with preexisting conditions, these folks would have access.There were many negative stereotypes associated with both groups. While some of these people were indeed very ill, it was also clear that the fact that people didn’t have insurance did not necessarily mean they were sick. In reality, many were healthy individuals who, for whatever reason, were uninsured. Some were seasonal workers in organizations that didn’t provide coverage to their employees, others opted not to buy coverage, and there were those who just could not afford it and would now be subsidized. Additionally, some with preexisting conditions had in the past been denied insurance coverage on the basis of relatively minor problems such as sinusitis, a prior knee injury, and removal of a small benign tumor and so on.This looked to Jim like bonanza. Jim wanted to find ways to connect these groups to his hospital, as well as its associated outpatient clinics and excellent pool of physicians and other health care professionals. This led him to thinking about new programs, modifying existing programs, developing marketing strategies, finding ways to capitalize on the pent-up demand for services in the short run, and becoming the provider of choice in the long run.(3) What marketing strategies might be developed to attract this new clientele?

How do bisphosphonates work to treat bone metastasis?

Topic: The immune system is a daunting system to cover. However, it is critical for a healthcare professional to understand how the immune system works. This week you will provide a written response that analyzes the mechanism of action for the three lines of defense in the immune system.Assignment Expectations:You will write a 2000-2250 word essay, not including the Title and References pages (typed,12 point font, double spaced).In addition, I have included a link to research article (Item 10). You should read and provide a review of this article in item 10.Required Topics to Address:Physical barriers, the first line of defenseThe second line of defense, the innate immune systemPhagocytosisImmunological SurveillanceInterferonsInflammationThe third line of defense, humoral immunityAntibody structure and classesThe third line of defense, cell-mediated immunityVaccines and pseudoscience (review this article and provide a summary:http://www.miottawa.org/Health/OCHD/pdf/2007_Nature_DeStefano_Vaccines_and_Autism.pdf)References- Support your content with at least (5) citations. Make sure to reference the citations using APA writing style for the presentation.

A typed 1-2 page paper (double spaced) including:? A brief history of the Adventist Health Message.? What impact has the Adventist Health Message on your personal life?? What influence has this class had on your thinking about the Adventist Heath Message?? What did you like most about the class?? How can this class be improved?

DNA Mutation Simulation – Access the simulation at: ?https://www.biologycorner.com/worksheets/DNA-sim.html 1) Transcribe and Translate your original DNA. Review those terms and write a short definition Transcription: Translation: 2) Identify the major players shown in the simulation: mRNA, Codon, Amino Acid, tRNA, anticodon, ribosome. Use the figure below to label these parts.3. When the protein is completed, write the sequence of amino acids shown, there are 11. (Hint: click the “stop” button to make the model stop jiggling.) 4. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG 5. Edit the DNA by changing all of the first triplet to AAA Check the new protein created by your new DNA. Describe how this changed the protein..biologycorner.comhttps://www.biologycorner.com/worksheets/DNA-sim.htmlhttp://www.biologycorner.com/6. Return the triplet to its original state (ATG). Now place an additional A after the G, your strand will read ATGA. ?Check the new protein created by your new DNA. Describe how this changed the protein. 7. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC. Check the new protein created by your new DNA. Describe how this changed the protein. Final Analysis – There are three mutations you explored in this activity. You can use what you observed in the activity to help you answer the questions or search other sources if you are still confused. 8. First, you created a ?POINT? mutation in your DNA. Describe what a point mutation is an how this can affect the protein created by the gene. 9. The second mutation you explored is called a ?FRAMESHIFT? mutation. Explain what this means and how it affects the protein. 10. The third mutation you explored is a special kind of point mutation called a ?SILENT? mutation. Explain what this means.www.biologycorner.comhttp://www.biologycorner.com/

write 2 pages in machine learning in bio informaticsrequirement:1- 3 to 4 references (journal)

read the article and find out the risk assessment which are explained in the paper: 1.hazard identification 2.dose-response evaluation 3.exposure assessment 4.risk characterization

Important ideas to understand as you watch the video:1. Is the symbiotic relationship between the coral and the algae parasitic or mutualistic? Why do you think this? If you need help, use this resource.2. How does the temperature of the water impact the algae?3. Why are the coral reefs becoming the white or “bleached” color?4. Do you think Australia should approve the coal mining? Why or why not?5. Do you think that this thermal pollution is point or nonpoint source? Why or why not?

Required ResourcesRead/review the following resources for this activity:Textbook: Chapter 13LessonMinimum of 1 scholarly source (in addition to the textbookIntroductionSome people believe that you can tell who a person is by what they do when no one is looking. Let’s look at the following case. John Doe, a nurse, has downloaded an application to her phone that allows him to download copyrighted textbooks for a nursing course (that Doe is going to take) without his Internet Service Provider knowing it. The application is called “Cloak” as in cloak of invisibility (a hooded coat one wears to make it so others cannot see you). The application disguises his phone and makes it so the information on it is inaccessible. John is aware that other people who are of a lower socio-economic status (like him) also use this software program for the same reason (and to save money). John Doe knows that his religion forbids him from using this application to download in this manner. John Doe is focused on his own economic situation and does not consider the publisher, author, and others involved in the books. Think about a course of social action; what social values should be used to address this moral issue and conflict.Initial Post InstructionsCreate a personal ethical philosophy and explain from which philosophy or philosophies (it must include at least one of the following: virtue ethics, Kantian ethics, utilitarianism, virtue ethics, or social contract ethics) you created it and why the contents are important and meaningful for you. List its precepts.Take your personal ethical philosophy statement and use it to work through John Doe’s case. What is moral and immoral per your theory?How would the veil of ignorance or a different theory of justice address John Doe’s case?Follow-Up Post InstructionsRespond to at least one peer. When possible, respond to a peer who chose a different ethical theory than you did in your posting. Further the dialogue by providing more information and clarification.Writing RequirementsMinimum of 2 posts (1 initial & 1 follow-up)Minimum of 2 sources cited (assigned readings/online lessons and an outside scholarly source)APA format for in-text citations and list of references